NCERT Solutions for Class 12 Biology Chapter 5 Molecular Basis of Inheritance

Molecular basis of Inheritance NCERT solutions explain the secret code inside our bodies called DNA. This chapter tells us how living things pass on traits, like eye color or height, from parents to children. It shows us how tiny molecules act like a library, keeping all the instructions for life safe and organized.
Check Out: CBSE Class 12th Books
NCERT Solutions for Class 12 Biology Chapter 5 Molecular Basis of Inheritance
Here is the NCERT Solution for Class 12 Biology Chapter 5 Molecular Basis of Inheritance:
1. Group the following as nitrogenous bases and nucleosides:
- Adenine, Cytidine, Thymine, Guanosine, Uracil, and Cytosine.
Solution:
| Nitrogenous Base | Nucleosides |
|---|---|
| Adenine | Cytidine |
| Thymine | Guanosine |
| Uracil | |
| Cytosine |
2. If a double-stranded DNA has 20 percent of cytosine, calculate the percent of adenine in the DNA.
Solution:
As per Chargaff’s rule, DNA molecules must have an equal ratio of purines (adenine and guanine) and pyrimidines (cytosine and thymine). This means that the number of adenine molecules is equivalent to the number of thymine molecules. Also, the percentage of guanine equals the percentage of cytosine.
- If the double-stranded DNA has 20% cytosine, it also has 20% guanine.
- Therefore, the combined percentage of guanine and cytosine is 40%.
- The remaining 60% consists of adenine and thymine, which are equal.
- Hence, the percentage of adenine = 30%.
Read More: NCERT Solutions for Class 12 Biology Chapter 1 Reproduction In Organisms
3. If the sequence of one strand of DNA is written as follows:
- 5′ -ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of the complementary strand in a 5’→3′ direction.
Solution:
The complementary sequence of the strand is obtained by replacing each base with its pair:
- A pairs with T, T pairs with A, G pairs with C, and C pairs with G.
Thus, the complementary strand in the 3′→5′ direction is:
- 3′ – TACGTACGTACGTACGTACGTACGTACG – 5′
Reversing this to 5′→3′ direction:
- 5′ – GCATGCATGCATGCATGCATGCATGCAT – 3′
4. If the sequence of the coding strand in a transcription unit is written as follows:
- 5′ -ATGCATGCATGCATGCATGCATGCATGC-3′
Write down the sequence of mRNA.
Solution:
In transcription, thymine (T) is replaced with uracil (U) in RNA. Therefore, the mRNA sequence corresponding to the coding strand is:
- 5′ -AUGCAUGCAUGCAUGCAUGCAUGCAUGC-3′
Read More: NCERT Solutions for Class 12 Biology Chapter 2 Sexual Reproduction In Flowering Plants
5. Which property of the DNA double helix led Watson and Crick to hypothesize a semi-conservative mode of DNA replication? Explain.
Solution: Watson and Crick proposed the semi-conservative model of DNA replication based on the observation that the two strands of DNA are complementary and anti-parallel. This means that each strand can serve as a template for the synthesis of a new complementary strand. Thus, during replication, each of the two strands would separate, and each would form a new complementary strand, resulting in two DNA molecules, each consisting of one old strand and one newly synthesized strand.
6. Depending upon the chemical nature of the template (DNA or RNA) and the nature of nucleic acids synthesized from it (DNA or RNA), list the types of nucleic acid polymerases.
Solution:
The types of nucleic acid polymerases are:
- DNA-dependent DNA polymerases
- DNA-dependent RNA polymerases
- RNA-dependent DNA polymerases
- RNA-dependent RNA polymerases
7. How did Hershey and Chase differentiate between DNA and protein in their experiment while proving that DNA is the genetic material?
Solution: Hershey and Chase used radioactive isotopes to label DNA and protein separately. They used phosphorus-32 (32P) to label DNA and sulfur-35 (35S) to label proteins. After the bacteriophages infected E. coli bacteria, they found that the radioactive phosphorus entered the bacteria, indicating that DNA, not protein, was transferred and thus carried the genetic material.
8. Differentiate between the following:
(a) Repetitive DNA and Satellite DNA
- Repetitive DNA : Sequences that are repeated several times in the genome. These sequences can vary in length from several base pairs to thousands.
- Satellite DNA : A subset of repetitive DNA, which consists of highly repetitive sequences and can be separated from bulk DNA by density gradient centrifugation.
(b) mRNA and tRNA
- mRNA : Serves as the template for protein synthesis, carrying the genetic information from DNA to the ribosome.
- tRNA : Carries amino acids to the ribosome during translation, matching the mRNA codon to the appropriate amino acid.
(c) Template Strand and Coding Strand
- Template Strand : The DNA strand that serves as the template for mRNA synthesis.
- Coding Strand : The DNA strand with the same sequence as the mRNA (except thymine is replaced with uracil in RNA).
Read More: NCERT Solutions for Class 12 Biology Chapter 3 Human Reproduction
9. List two essential roles of the ribosome during translation.
Solution:
- Ribosomes are the sites for protein synthesis, where amino acids are linked to form polypeptide chains.
- Ribosomes facilitate the attachment of tRNA, allowing the amino acids to align properly for peptide bond formation.
10. In the medium where E. coli was growing, lactose was added, which induced the lac operon. Why does the lac operon shut down sometime after the addition of lactose in the medium?
Solution:
The lac operon is activated when lactose binds to the repressor, inactivating it, allowing RNA polymerase to transcribe the operon. However, once lactose is metabolized and its concentration decreases, the repressor is synthesized again, binds to the operator region, and prevents RNA polymerase from transcribing the operon, thereby shutting it down.
11. Explain (in one or two lines) the function of the following:
- (a) Promoter : A region of DNA where RNA polymerase binds to initiate transcription.
- (b) tRNA : An adaptor molecule that transfers specific amino acids to the ribosome during protein synthesis.
- (c) Exons : Coding sequences in DNA that are transcribed into mRNA and translated into proteins.
12. Why is the Human Genome Project called a mega project?
Solution:
The Human Genome Project is called a mega project because it aimed to map and sequence all the genes in the human genome, which took over 13 years to complete. The project had a massive scale and scope, contributing to advancements in genetics, biotechnology, and medicine.
13. What is DNA fingerprinting? Mention its application.
Solution:
DNA fingerprinting is a technique used to identify and analyze variations in DNA sequences. Applications include:
- Forensic identification (crime scene investigation).
- Establishing paternity or family relationships.
- Identifying genetic diversity in species.
- Preserving commercial strains of plants and animals.
14. Briefly describe the following:
- (a) Transcription : The process of synthesizing RNA from a DNA template, resulting in mRNA formation.
- (b) Polymorphism : Genetic variation in a population due to differences in DNA sequences.
- (c) Translation : The process where mRNA is decoded by ribosomes to synthesize a polypeptide chain.
- (d) Bioinformatics : The application of computational tools to analyze and interpret biological data, such as DNA sequences.
Read More: NCERT Solutions for Class 12 Biology Chapter 4
1. Basics of NCERT Solutions for Class 12 Biology Chapter 5 Molecular Basis of Inheritance
Inside every tiny part of your body, there is a very long, thin string called DNA. In these molecular basis inheritance ncert solutions, we learn that DNA is like a giant instruction book. It tells your body how to grow and how to work every single day. We don't just guess how this works; we use science to see it.
-
DNA: This is a long chain made of smaller bits. It looks like a twisted ladder.
-
RNA: This is like a helper. It takes the messages from the DNA and helps make things happen.
-
Nucleotides: These are the "bricks" used to build the DNA ladder.
-
The Code: There are four special letters (A, T, G, and C) that make up the secret code of life.
|
Part |
What it is |
What it does |
|
DNA |
Deoxyribonucleic Acid |
Stores the main secret code |
|
RNA |
Ribonucleic Acid |
Carries messages and builds proteins |
|
Genes |
Small sections of DNA |
Give specific instructions like "make hair brown" |
2. Using Molecular Basis of Inheritance NCERT Solutions PDF
When you look at a molecular basis of inheritance NCERT solutions pdf, you will see how scientists proved that DNA is the most important molecule. For a long time, people weren't sure what carried our secrets. They thought it might be proteins, but experiments showed it was DNA. This is a vital part of our history.
The Search for the Code
Scientists like Griffith and Avery did smart tests with tiny germs. They found that something could move from one germ to another and change it. Later, Hershey and Chase used "glow-in-the-dark" markers to show that DNA is the boss. They used a tiny virus to prove this, which was very clever!
The Shape of DNA
Watson and Crick found out that DNA is a "Double Helix." This is just a easy way of saying it is a ladder that has been twisted around like a screw. This shape is very strong and helps keep our information safe. You can see great pictures of this in the molecular basis of inheritance NCERT solutions class 12 notes.
3. How DNA Copies Itself for Class 12
Every time your body makes a new cell, it needs a new copy of the instruction book. This part of the molecular basis of inheritance NCERT solutions pw explains the "copy-paste" machine of the cell. If the copy is wrong, it can cause problems, so the cell is very careful.
-
Replication: This is when one DNA ladder unzips down the middle and makes two new ladders that are exactly the same.
-
Unzipping: Special helpers called enzymes act like a zipper to open the DNA.
-
Matching: Because A always likes T, and G always likes C, the new ladders are perfect copies.
-
Semi-Conservative: This just means the new ladders are half-old and half-new.
Getting a molecular basis of inheritance NCERT solutions pdf download will help you see the steps of this unzipping process very clearly.
4. Transcription and Translation in Simple Words
How does the DNA book actually build your body? It uses a two-step plan. These steps are a big part of the molecular basis of inheritance NCERT solutions class 12. We call this the "Central Dogma" of biology.
Step 1: Transcription (Copying the Message)
Since the DNA stays safe inside a "room" called the nucleus, it sends a copy of its instructions out. This copy is called mRNA. It is like taking a photo of a recipe from a cookbook so you don't have to take the whole book into the kitchen. The kitchen is the rest of the cell.
Step 2: Translation (Building the Parts)
The mRNA goes to a "factory" in the cell called a ribosome. Here, the code reads three letters at a time. Each three-letter word stands for a "building block" called an amino acid. When you string these blocks together, you get protein. Proteins are what actually make your skin, hair, and muscles!
You can find the "Dictionary" for these three-letter words in your molecular basis of inheritance ncert solutions.
Check Out: Class 12th Sample Papers
5. Human Genome and Fingerprinting for 2026
At the end of the chapter, we learn about big projects and cool police work. The molecular basis of inheritance NCERT solutions show us how we use DNA in the real world today. It is quite amazing what we can do with this knowledge.
-
Human Genome Project: Scientists spent years reading every single letter of the human DNA book. They found out we have about 3 billion letters!
-
DNA Fingerprinting: Every person (except identical twins) has a slightly different code. Police use this to find out who was at a crime scene. It is also used to see if people are related.
-
Regulation: Your body doesn't read all the instructions at once. It turns some genes "on" and some "off" when it needs them. This is like turning the lights on in a room only when you are using it.
For your exam, make sure to check the molecular basis of inheritance NCERT solutions pdf download for the diagram of the "Lac Operon," which shows how a tiny germ turns its genes on and off to eat sugar.
Check Out: Class 12th Question Banks
Class 12 Biology Chapter 5 FAQs
1. What is the full name of DNA?
DNA stands for Deoxyribonucleic Acid. It is the molecule that carries all your traits.
2. Who found the shape of DNA?
James Watson and Francis Crick found the twisted ladder shape, which they called a Double Helix.
3. What is a "Codon"?
A codon is a group of three letters (like AUG) in the genetic code. Each group tells the cell which building block to add next.
4. Why is RNA important if we have DNA?
DNA is too big and important to leave its safe room. RNA is a smaller helper that carries the message to the factory so the body can actually build things.
5. How do molecular basis inheritance ncert solutions help in exams?
They give you the exact answers to book questions. They use simple drawings and steps that make it easy for you to get full marks.










